ID: 1180383438

View in Genome Browser
Species Human (GRCh38)
Location 22:12162632-12162654
Sequence TGCCAGACCCTGTCCCGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180383434_1180383438 -8 Left 1180383434 22:12162617-12162639 CCTGGCCTGAGAGCCTGCCAGAC No data
Right 1180383438 22:12162632-12162654 TGCCAGACCCTGTCCCGGCCCGG No data
1180383433_1180383438 -7 Left 1180383433 22:12162616-12162638 CCCTGGCCTGAGAGCCTGCCAGA No data
Right 1180383438 22:12162632-12162654 TGCCAGACCCTGTCCCGGCCCGG No data
1180383430_1180383438 11 Left 1180383430 22:12162598-12162620 CCTCTGGATCGCGGGTGCCCCTG No data
Right 1180383438 22:12162632-12162654 TGCCAGACCCTGTCCCGGCCCGG No data
1180383426_1180383438 21 Left 1180383426 22:12162588-12162610 CCCTGGGCAGCCTCTGGATCGCG No data
Right 1180383438 22:12162632-12162654 TGCCAGACCCTGTCCCGGCCCGG No data
1180383432_1180383438 -6 Left 1180383432 22:12162615-12162637 CCCCTGGCCTGAGAGCCTGCCAG No data
Right 1180383438 22:12162632-12162654 TGCCAGACCCTGTCCCGGCCCGG No data
1180383427_1180383438 20 Left 1180383427 22:12162589-12162611 CCTGGGCAGCCTCTGGATCGCGG No data
Right 1180383438 22:12162632-12162654 TGCCAGACCCTGTCCCGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180383438 Original CRISPR TGCCAGACCCTGTCCCGGCC CGG Intergenic
No off target data available for this crispr