ID: 1180384874

View in Genome Browser
Species Human (GRCh38)
Location 22:12171051-12171073
Sequence GTGTGACAGTAGCAAGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180384871_1180384874 8 Left 1180384871 22:12171020-12171042 CCATTAAAAGGGGCCTTTTCTGC No data
Right 1180384874 22:12171051-12171073 GTGTGACAGTAGCAAGTAGATGG No data
1180384873_1180384874 -5 Left 1180384873 22:12171033-12171055 CCTTTTCTGCTGGCAAGAGTGTG No data
Right 1180384874 22:12171051-12171073 GTGTGACAGTAGCAAGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180384874 Original CRISPR GTGTGACAGTAGCAAGTAGA TGG Intergenic
No off target data available for this crispr