ID: 1180385267

View in Genome Browser
Species Human (GRCh38)
Location 22:12173258-12173280
Sequence CTGGGGGACCCCTGGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180385257_1180385267 8 Left 1180385257 22:12173227-12173249 CCGCTCATATTCTCCCGAGACCT No data
Right 1180385267 22:12173258-12173280 CTGGGGGACCCCTGGGTGCATGG No data
1180385259_1180385267 -5 Left 1180385259 22:12173240-12173262 CCCGAGACCTGTGAGTCTCTGGG No data
Right 1180385267 22:12173258-12173280 CTGGGGGACCCCTGGGTGCATGG No data
1180385261_1180385267 -6 Left 1180385261 22:12173241-12173263 CCGAGACCTGTGAGTCTCTGGGG No data
Right 1180385267 22:12173258-12173280 CTGGGGGACCCCTGGGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180385267 Original CRISPR CTGGGGGACCCCTGGGTGCA TGG Intergenic
No off target data available for this crispr