ID: 1180385698

View in Genome Browser
Species Human (GRCh38)
Location 22:12175695-12175717
Sequence AGGGAGAAGCTGGGTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180385698_1180385714 22 Left 1180385698 22:12175695-12175717 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1180385714 22:12175740-12175762 CCAAGGGGCAGCTCCTCACCAGG No data
1180385698_1180385715 23 Left 1180385698 22:12175695-12175717 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1180385715 22:12175741-12175763 CAAGGGGCAGCTCCTCACCAGGG No data
1180385698_1180385708 6 Left 1180385698 22:12175695-12175717 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1180385708 22:12175724-12175746 TCCCAGAAACTCAGACCCAAGGG No data
1180385698_1180385716 29 Left 1180385698 22:12175695-12175717 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1180385716 22:12175747-12175769 GCAGCTCCTCACCAGGGATGTGG No data
1180385698_1180385707 5 Left 1180385698 22:12175695-12175717 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1180385707 22:12175723-12175745 CTCCCAGAAACTCAGACCCAAGG No data
1180385698_1180385710 7 Left 1180385698 22:12175695-12175717 CCTGCCTCACCCAGCTTCTCCCT No data
Right 1180385710 22:12175725-12175747 CCCAGAAACTCAGACCCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180385698 Original CRISPR AGGGAGAAGCTGGGTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr