ID: 1180386091

View in Genome Browser
Species Human (GRCh38)
Location 22:12177819-12177841
Sequence GTGTGACAGTAGCAAGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180386091_1180386092 -5 Left 1180386091 22:12177819-12177841 CCATCTACTTGCTACTGTCACAC No data
Right 1180386092 22:12177837-12177859 CACACTCTTGCCAGCAGAAGAGG No data
1180386091_1180386094 7 Left 1180386091 22:12177819-12177841 CCATCTACTTGCTACTGTCACAC No data
Right 1180386094 22:12177849-12177871 AGCAGAAGAGGCCCCTGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180386091 Original CRISPR GTGTGACAGTAGCAAGTAGA TGG (reversed) Intergenic
No off target data available for this crispr