ID: 1180388237

View in Genome Browser
Species Human (GRCh38)
Location 22:12199775-12199797
Sequence AGCTATATTTTACATTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180388237_1180388239 30 Left 1180388237 22:12199775-12199797 CCTTCACAATGTAAAATATAGCT No data
Right 1180388239 22:12199828-12199850 TTCCACTGTGTTAAATTGAGTGG No data
1180388237_1180388238 -5 Left 1180388237 22:12199775-12199797 CCTTCACAATGTAAAATATAGCT No data
Right 1180388238 22:12199793-12199815 TAGCTACTTTGATACACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180388237 Original CRISPR AGCTATATTTTACATTGTGA AGG (reversed) Intergenic
No off target data available for this crispr