ID: 1180391729

View in Genome Browser
Species Human (GRCh38)
Location 22:12290013-12290035
Sequence CTCTGCAAATAAAATAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180391729_1180391731 13 Left 1180391729 22:12290013-12290035 CCAACTTTATTTTATTTGCAGAG No data
Right 1180391731 22:12290049-12290071 AGACATTCAGGAAACAAGTCTGG No data
1180391729_1180391730 1 Left 1180391729 22:12290013-12290035 CCAACTTTATTTTATTTGCAGAG No data
Right 1180391730 22:12290037-12290059 TAAAGTTTAAATAGACATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180391729 Original CRISPR CTCTGCAAATAAAATAAAGT TGG (reversed) Intergenic
No off target data available for this crispr