ID: 1180392601

View in Genome Browser
Species Human (GRCh38)
Location 22:12298287-12298309
Sequence TGATGTGCTTGGTGTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180392597_1180392601 -9 Left 1180392597 22:12298273-12298295 CCCAGTCAGACAGGTGATGTGCT No data
Right 1180392601 22:12298287-12298309 TGATGTGCTTGGTGTGAGCTGGG No data
1180392598_1180392601 -10 Left 1180392598 22:12298274-12298296 CCAGTCAGACAGGTGATGTGCTT No data
Right 1180392601 22:12298287-12298309 TGATGTGCTTGGTGTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180392601 Original CRISPR TGATGTGCTTGGTGTGAGCT GGG Intergenic
No off target data available for this crispr