ID: 1180393940

View in Genome Browser
Species Human (GRCh38)
Location 22:12312193-12312215
Sequence GCCCCACGGGACCTGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180393940_1180393946 19 Left 1180393940 22:12312193-12312215 CCTTCACTCAGGTCCCGTGGGGC No data
Right 1180393946 22:12312235-12312257 CAGTCTTCTTTCTTTGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180393940 Original CRISPR GCCCCACGGGACCTGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr