ID: 1180393946

View in Genome Browser
Species Human (GRCh38)
Location 22:12312235-12312257
Sequence CAGTCTTCTTTCTTTGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180393941_1180393946 6 Left 1180393941 22:12312206-12312228 CCCGTGGGGCCTGCCCTCTAAAG No data
Right 1180393946 22:12312235-12312257 CAGTCTTCTTTCTTTGTTCATGG No data
1180393934_1180393946 26 Left 1180393934 22:12312186-12312208 CCAAACCCCTTCACTCAGGTCCC No data
Right 1180393946 22:12312235-12312257 CAGTCTTCTTTCTTTGTTCATGG No data
1180393942_1180393946 5 Left 1180393942 22:12312207-12312229 CCGTGGGGCCTGCCCTCTAAAGT No data
Right 1180393946 22:12312235-12312257 CAGTCTTCTTTCTTTGTTCATGG No data
1180393938_1180393946 20 Left 1180393938 22:12312192-12312214 CCCTTCACTCAGGTCCCGTGGGG No data
Right 1180393946 22:12312235-12312257 CAGTCTTCTTTCTTTGTTCATGG No data
1180393936_1180393946 21 Left 1180393936 22:12312191-12312213 CCCCTTCACTCAGGTCCCGTGGG No data
Right 1180393946 22:12312235-12312257 CAGTCTTCTTTCTTTGTTCATGG No data
1180393933_1180393946 27 Left 1180393933 22:12312185-12312207 CCCAAACCCCTTCACTCAGGTCC No data
Right 1180393946 22:12312235-12312257 CAGTCTTCTTTCTTTGTTCATGG No data
1180393945_1180393946 -8 Left 1180393945 22:12312220-12312242 CCTCTAAAGTCTCTTCAGTCTTC No data
Right 1180393946 22:12312235-12312257 CAGTCTTCTTTCTTTGTTCATGG No data
1180393944_1180393946 -7 Left 1180393944 22:12312219-12312241 CCCTCTAAAGTCTCTTCAGTCTT No data
Right 1180393946 22:12312235-12312257 CAGTCTTCTTTCTTTGTTCATGG No data
1180393940_1180393946 19 Left 1180393940 22:12312193-12312215 CCTTCACTCAGGTCCCGTGGGGC No data
Right 1180393946 22:12312235-12312257 CAGTCTTCTTTCTTTGTTCATGG No data
1180393943_1180393946 -3 Left 1180393943 22:12312215-12312237 CCTGCCCTCTAAAGTCTCTTCAG No data
Right 1180393946 22:12312235-12312257 CAGTCTTCTTTCTTTGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180393946 Original CRISPR CAGTCTTCTTTCTTTGTTCA TGG Intergenic
No off target data available for this crispr