ID: 1180404568

View in Genome Browser
Species Human (GRCh38)
Location 22:12539530-12539552
Sequence TCCTATCCATGAGCATGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180404568_1180404570 -1 Left 1180404568 22:12539530-12539552 CCACCTCATGCTCATGGATAGGA No data
Right 1180404570 22:12539552-12539574 AAGATCCAATATAACTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180404568 Original CRISPR TCCTATCCATGAGCATGAGG TGG (reversed) Intergenic
No off target data available for this crispr