ID: 1180405801

View in Genome Browser
Species Human (GRCh38)
Location 22:12552515-12552537
Sequence CAGTCTTCTTTCTTTGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180405801_1180405804 -3 Left 1180405801 22:12552515-12552537 CCATGAACAAAGAAAGAAGACTG No data
Right 1180405804 22:12552535-12552557 CTGAAGAGACTTTAGAGGGCAGG No data
1180405801_1180405802 -8 Left 1180405801 22:12552515-12552537 CCATGAACAAAGAAAGAAGACTG No data
Right 1180405802 22:12552530-12552552 GAAGACTGAAGAGACTTTAGAGG No data
1180405801_1180405806 6 Left 1180405801 22:12552515-12552537 CCATGAACAAAGAAAGAAGACTG No data
Right 1180405806 22:12552544-12552566 CTTTAGAGGGCAGGCCCCACGGG No data
1180405801_1180405807 19 Left 1180405801 22:12552515-12552537 CCATGAACAAAGAAAGAAGACTG No data
Right 1180405807 22:12552557-12552579 GCCCCACGGGACCTGAGTGAAGG No data
1180405801_1180405803 -7 Left 1180405801 22:12552515-12552537 CCATGAACAAAGAAAGAAGACTG No data
Right 1180405803 22:12552531-12552553 AAGACTGAAGAGACTTTAGAGGG No data
1180405801_1180405811 21 Left 1180405801 22:12552515-12552537 CCATGAACAAAGAAAGAAGACTG No data
Right 1180405811 22:12552559-12552581 CCCACGGGACCTGAGTGAAGGGG No data
1180405801_1180405813 26 Left 1180405801 22:12552515-12552537 CCATGAACAAAGAAAGAAGACTG No data
Right 1180405813 22:12552564-12552586 GGGACCTGAGTGAAGGGGTTTGG No data
1180405801_1180405805 5 Left 1180405801 22:12552515-12552537 CCATGAACAAAGAAAGAAGACTG No data
Right 1180405805 22:12552543-12552565 ACTTTAGAGGGCAGGCCCCACGG No data
1180405801_1180405814 27 Left 1180405801 22:12552515-12552537 CCATGAACAAAGAAAGAAGACTG No data
Right 1180405814 22:12552565-12552587 GGACCTGAGTGAAGGGGTTTGGG No data
1180405801_1180405809 20 Left 1180405801 22:12552515-12552537 CCATGAACAAAGAAAGAAGACTG No data
Right 1180405809 22:12552558-12552580 CCCCACGGGACCTGAGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180405801 Original CRISPR CAGTCTTCTTTCTTTGTTCA TGG (reversed) Intergenic
No off target data available for this crispr