ID: 1180405807

View in Genome Browser
Species Human (GRCh38)
Location 22:12552557-12552579
Sequence GCCCCACGGGACCTGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180405801_1180405807 19 Left 1180405801 22:12552515-12552537 CCATGAACAAAGAAAGAAGACTG No data
Right 1180405807 22:12552557-12552579 GCCCCACGGGACCTGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180405807 Original CRISPR GCCCCACGGGACCTGAGTGA AGG Intergenic
No off target data available for this crispr