ID: 1180407147

View in Genome Browser
Species Human (GRCh38)
Location 22:12566481-12566503
Sequence TGATGTGCTTGGTGTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180407147_1180407150 -10 Left 1180407147 22:12566481-12566503 CCCAGCTCACACCAAGCACATCA No data
Right 1180407150 22:12566494-12566516 AAGCACATCACCTGTCTGACTGG No data
1180407147_1180407151 -9 Left 1180407147 22:12566481-12566503 CCCAGCTCACACCAAGCACATCA No data
Right 1180407151 22:12566495-12566517 AGCACATCACCTGTCTGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180407147 Original CRISPR TGATGTGCTTGGTGTGAGCT GGG (reversed) Intergenic
No off target data available for this crispr