ID: 1180408016 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:12574743-12574765 |
Sequence | CTCTGCAAATAAAATAAAGT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1180408015_1180408016 | 1 | Left | 1180408015 | 22:12574719-12574741 | CCTGAATGTCTATTTAAACTTTA | No data | ||
Right | 1180408016 | 22:12574743-12574765 | CTCTGCAAATAAAATAAAGTTGG | No data | ||||
1180408014_1180408016 | 13 | Left | 1180408014 | 22:12574707-12574729 | CCAGACTTGTTTCCTGAATGTCT | No data | ||
Right | 1180408016 | 22:12574743-12574765 | CTCTGCAAATAAAATAAAGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1180408016 | Original CRISPR | CTCTGCAAATAAAATAAAGT TGG | Intergenic | ||
No off target data available for this crispr |