ID: 1180408016

View in Genome Browser
Species Human (GRCh38)
Location 22:12574743-12574765
Sequence CTCTGCAAATAAAATAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180408015_1180408016 1 Left 1180408015 22:12574719-12574741 CCTGAATGTCTATTTAAACTTTA No data
Right 1180408016 22:12574743-12574765 CTCTGCAAATAAAATAAAGTTGG No data
1180408014_1180408016 13 Left 1180408014 22:12574707-12574729 CCAGACTTGTTTCCTGAATGTCT No data
Right 1180408016 22:12574743-12574765 CTCTGCAAATAAAATAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180408016 Original CRISPR CTCTGCAAATAAAATAAAGT TGG Intergenic
No off target data available for this crispr