ID: 1180408861

View in Genome Browser
Species Human (GRCh38)
Location 22:12584019-12584041
Sequence AACCCCTTGCTGTTGCTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180408858_1180408861 25 Left 1180408858 22:12583971-12583993 CCTACAAAAAAATCATTTTTTAT No data
Right 1180408861 22:12584019-12584041 AACCCCTTGCTGTTGCTTTAGGG No data
1180408857_1180408861 26 Left 1180408857 22:12583970-12583992 CCCTACAAAAAAATCATTTTTTA No data
Right 1180408861 22:12584019-12584041 AACCCCTTGCTGTTGCTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180408861 Original CRISPR AACCCCTTGCTGTTGCTTTA GGG Intergenic
No off target data available for this crispr