ID: 1180410131

View in Genome Browser
Species Human (GRCh38)
Location 22:12599158-12599180
Sequence GTAGCTATTCTGACTGGTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180410125_1180410131 26 Left 1180410125 22:12599109-12599131 CCTTTTCTCCAGAGCCTCCCAAG No data
Right 1180410131 22:12599158-12599180 GTAGCTATTCTGACTGGTATAGG No data
1180410128_1180410131 9 Left 1180410128 22:12599126-12599148 CCCAAGATCTGTTGTTTTTCGAT No data
Right 1180410131 22:12599158-12599180 GTAGCTATTCTGACTGGTATAGG No data
1180410126_1180410131 18 Left 1180410126 22:12599117-12599139 CCAGAGCCTCCCAAGATCTGTTG No data
Right 1180410131 22:12599158-12599180 GTAGCTATTCTGACTGGTATAGG No data
1180410124_1180410131 27 Left 1180410124 22:12599108-12599130 CCCTTTTCTCCAGAGCCTCCCAA No data
Right 1180410131 22:12599158-12599180 GTAGCTATTCTGACTGGTATAGG No data
1180410129_1180410131 8 Left 1180410129 22:12599127-12599149 CCAAGATCTGTTGTTTTTCGATT No data
Right 1180410131 22:12599158-12599180 GTAGCTATTCTGACTGGTATAGG No data
1180410127_1180410131 12 Left 1180410127 22:12599123-12599145 CCTCCCAAGATCTGTTGTTTTTC No data
Right 1180410131 22:12599158-12599180 GTAGCTATTCTGACTGGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180410131 Original CRISPR GTAGCTATTCTGACTGGTAT AGG Intergenic
No off target data available for this crispr