ID: 1180411743

View in Genome Browser
Species Human (GRCh38)
Location 22:12617976-12617998
Sequence CTGTGTTTTGGGAAGGCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180411743_1180411750 27 Left 1180411743 22:12617976-12617998 CCCATTGCCTTCCCAAAACACAG No data
Right 1180411750 22:12618026-12618048 ACATGCATCTTTTGAACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180411743 Original CRISPR CTGTGTTTTGGGAAGGCAAT GGG (reversed) Intergenic
No off target data available for this crispr