ID: 1180413354

View in Genome Browser
Species Human (GRCh38)
Location 22:12637057-12637079
Sequence AAGTCCTTCTAGAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180413352_1180413354 2 Left 1180413352 22:12637032-12637054 CCATGGAAAAAGGACCTATCAAA No data
Right 1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG No data
1180413350_1180413354 18 Left 1180413350 22:12637016-12637038 CCTCTTTTATTCTAAACCATGGA 0: 17
1: 21
2: 24
3: 47
4: 248
Right 1180413354 22:12637057-12637079 AAGTCCTTCTAGAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180413354 Original CRISPR AAGTCCTTCTAGAAGAGTGA AGG Intergenic
No off target data available for this crispr