ID: 1180414282

View in Genome Browser
Species Human (GRCh38)
Location 22:12693985-12694007
Sequence CCCAACCTGCCCCAGCACGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180414282_1180414294 20 Left 1180414282 22:12693985-12694007 CCCGCGTGCTGGGGCAGGTTGGG No data
Right 1180414294 22:12694028-12694050 GCCAGGCTGGCCTGGAGCACAGG No data
1180414282_1180414293 12 Left 1180414282 22:12693985-12694007 CCCGCGTGCTGGGGCAGGTTGGG No data
Right 1180414293 22:12694020-12694042 CCGGCACGGCCAGGCTGGCCTGG No data
1180414282_1180414285 -7 Left 1180414282 22:12693985-12694007 CCCGCGTGCTGGGGCAGGTTGGG No data
Right 1180414285 22:12694001-12694023 GGTTGGGAGATCCCCTCTGCCGG No data
1180414282_1180414297 25 Left 1180414282 22:12693985-12694007 CCCGCGTGCTGGGGCAGGTTGGG No data
Right 1180414297 22:12694033-12694055 GCTGGCCTGGAGCACAGGGACGG No data
1180414282_1180414291 7 Left 1180414282 22:12693985-12694007 CCCGCGTGCTGGGGCAGGTTGGG No data
Right 1180414291 22:12694015-12694037 CTCTGCCGGCACGGCCAGGCTGG No data
1180414282_1180414286 -2 Left 1180414282 22:12693985-12694007 CCCGCGTGCTGGGGCAGGTTGGG No data
Right 1180414286 22:12694006-12694028 GGAGATCCCCTCTGCCGGCACGG No data
1180414282_1180414287 3 Left 1180414282 22:12693985-12694007 CCCGCGTGCTGGGGCAGGTTGGG No data
Right 1180414287 22:12694011-12694033 TCCCCTCTGCCGGCACGGCCAGG No data
1180414282_1180414296 21 Left 1180414282 22:12693985-12694007 CCCGCGTGCTGGGGCAGGTTGGG No data
Right 1180414296 22:12694029-12694051 CCAGGCTGGCCTGGAGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180414282 Original CRISPR CCCAACCTGCCCCAGCACGC GGG (reversed) Intergenic