ID: 1180414288

View in Genome Browser
Species Human (GRCh38)
Location 22:12694012-12694034
Sequence GCCTGGCCGTGCCGGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180414288_1180414294 -7 Left 1180414288 22:12694012-12694034 CCCCTCTGCCGGCACGGCCAGGC No data
Right 1180414294 22:12694028-12694050 GCCAGGCTGGCCTGGAGCACAGG No data
1180414288_1180414297 -2 Left 1180414288 22:12694012-12694034 CCCCTCTGCCGGCACGGCCAGGC No data
Right 1180414297 22:12694033-12694055 GCTGGCCTGGAGCACAGGGACGG No data
1180414288_1180414299 12 Left 1180414288 22:12694012-12694034 CCCCTCTGCCGGCACGGCCAGGC No data
Right 1180414299 22:12694047-12694069 CAGGGACGGCCCTCGCTCCCTGG No data
1180414288_1180414296 -6 Left 1180414288 22:12694012-12694034 CCCCTCTGCCGGCACGGCCAGGC No data
Right 1180414296 22:12694029-12694051 CCAGGCTGGCCTGGAGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180414288 Original CRISPR GCCTGGCCGTGCCGGCAGAG GGG (reversed) Intergenic
No off target data available for this crispr