ID: 1180414290

View in Genome Browser
Species Human (GRCh38)
Location 22:12694014-12694036
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180414290_1180414294 -9 Left 1180414290 22:12694014-12694036 CCTCTGCCGGCACGGCCAGGCTG No data
Right 1180414294 22:12694028-12694050 GCCAGGCTGGCCTGGAGCACAGG No data
1180414290_1180414299 10 Left 1180414290 22:12694014-12694036 CCTCTGCCGGCACGGCCAGGCTG No data
Right 1180414299 22:12694047-12694069 CAGGGACGGCCCTCGCTCCCTGG No data
1180414290_1180414296 -8 Left 1180414290 22:12694014-12694036 CCTCTGCCGGCACGGCCAGGCTG No data
Right 1180414296 22:12694029-12694051 CCAGGCTGGCCTGGAGCACAGGG No data
1180414290_1180414297 -4 Left 1180414290 22:12694014-12694036 CCTCTGCCGGCACGGCCAGGCTG No data
Right 1180414297 22:12694033-12694055 GCTGGCCTGGAGCACAGGGACGG No data
1180414290_1180414304 30 Left 1180414290 22:12694014-12694036 CCTCTGCCGGCACGGCCAGGCTG No data
Right 1180414304 22:12694067-12694089 TGGCTCACGAAAGCCCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180414290 Original CRISPR CAGCCTGGCCGTGCCGGCAG AGG (reversed) Intergenic