ID: 1180414292

View in Genome Browser
Species Human (GRCh38)
Location 22:12694020-12694042
Sequence CCAGGCCAGCCTGGCCGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180414292_1180414305 25 Left 1180414292 22:12694020-12694042 CCGGCACGGCCAGGCTGGCCTGG No data
Right 1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG 0: 1
1: 38
2: 10
3: 18
4: 74
1180414292_1180414304 24 Left 1180414292 22:12694020-12694042 CCGGCACGGCCAGGCTGGCCTGG No data
Right 1180414304 22:12694067-12694089 TGGCTCACGAAAGCCCCCTGAGG No data
1180414292_1180414299 4 Left 1180414292 22:12694020-12694042 CCGGCACGGCCAGGCTGGCCTGG No data
Right 1180414299 22:12694047-12694069 CAGGGACGGCCCTCGCTCCCTGG No data
1180414292_1180414297 -10 Left 1180414292 22:12694020-12694042 CCGGCACGGCCAGGCTGGCCTGG No data
Right 1180414297 22:12694033-12694055 GCTGGCCTGGAGCACAGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180414292 Original CRISPR CCAGGCCAGCCTGGCCGTGC CGG (reversed) Intergenic