ID: 1180414295

View in Genome Browser
Species Human (GRCh38)
Location 22:12694029-12694051
Sequence CCCTGTGCTCCAGGCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180414295_1180414304 15 Left 1180414295 22:12694029-12694051 CCAGGCTGGCCTGGAGCACAGGG No data
Right 1180414304 22:12694067-12694089 TGGCTCACGAAAGCCCCCTGAGG No data
1180414295_1180414299 -5 Left 1180414295 22:12694029-12694051 CCAGGCTGGCCTGGAGCACAGGG No data
Right 1180414299 22:12694047-12694069 CAGGGACGGCCCTCGCTCCCTGG No data
1180414295_1180414306 27 Left 1180414295 22:12694029-12694051 CCAGGCTGGCCTGGAGCACAGGG No data
Right 1180414306 22:12694079-12694101 GCCCCCTGAGGGAGAGCCCCAGG No data
1180414295_1180414305 16 Left 1180414295 22:12694029-12694051 CCAGGCTGGCCTGGAGCACAGGG No data
Right 1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG 0: 1
1: 38
2: 10
3: 18
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180414295 Original CRISPR CCCTGTGCTCCAGGCCAGCC TGG (reversed) Intergenic