ID: 1180414297

View in Genome Browser
Species Human (GRCh38)
Location 22:12694033-12694055
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180414290_1180414297 -4 Left 1180414290 22:12694014-12694036 CCTCTGCCGGCACGGCCAGGCTG No data
Right 1180414297 22:12694033-12694055 GCTGGCCTGGAGCACAGGGACGG No data
1180414284_1180414297 24 Left 1180414284 22:12693986-12694008 CCGCGTGCTGGGGCAGGTTGGGA No data
Right 1180414297 22:12694033-12694055 GCTGGCCTGGAGCACAGGGACGG No data
1180414280_1180414297 26 Left 1180414280 22:12693984-12694006 CCCCGCGTGCTGGGGCAGGTTGG No data
Right 1180414297 22:12694033-12694055 GCTGGCCTGGAGCACAGGGACGG No data
1180414292_1180414297 -10 Left 1180414292 22:12694020-12694042 CCGGCACGGCCAGGCTGGCCTGG No data
Right 1180414297 22:12694033-12694055 GCTGGCCTGGAGCACAGGGACGG No data
1180414289_1180414297 -3 Left 1180414289 22:12694013-12694035 CCCTCTGCCGGCACGGCCAGGCT No data
Right 1180414297 22:12694033-12694055 GCTGGCCTGGAGCACAGGGACGG No data
1180414282_1180414297 25 Left 1180414282 22:12693985-12694007 CCCGCGTGCTGGGGCAGGTTGGG No data
Right 1180414297 22:12694033-12694055 GCTGGCCTGGAGCACAGGGACGG No data
1180414288_1180414297 -2 Left 1180414288 22:12694012-12694034 CCCCTCTGCCGGCACGGCCAGGC No data
Right 1180414297 22:12694033-12694055 GCTGGCCTGGAGCACAGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180414297 Original CRISPR GCTGGCCTGGAGCACAGGGA CGG Intergenic