ID: 1180414298

View in Genome Browser
Species Human (GRCh38)
Location 22:12694038-12694060
Sequence GAGGGCCGTCCCTGTGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180414298_1180414306 18 Left 1180414298 22:12694038-12694060 CCTGGAGCACAGGGACGGCCCTC No data
Right 1180414306 22:12694079-12694101 GCCCCCTGAGGGAGAGCCCCAGG No data
1180414298_1180414304 6 Left 1180414298 22:12694038-12694060 CCTGGAGCACAGGGACGGCCCTC No data
Right 1180414304 22:12694067-12694089 TGGCTCACGAAAGCCCCCTGAGG 0: 38
1: 12
2: 10
3: 8
4: 115
1180414298_1180414305 7 Left 1180414298 22:12694038-12694060 CCTGGAGCACAGGGACGGCCCTC No data
Right 1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180414298 Original CRISPR GAGGGCCGTCCCTGTGCTCC AGG (reversed) Intergenic
No off target data available for this crispr