ID: 1180414299

View in Genome Browser
Species Human (GRCh38)
Location 22:12694047-12694069
Sequence CAGGGACGGCCCTCGCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180414295_1180414299 -5 Left 1180414295 22:12694029-12694051 CCAGGCTGGCCTGGAGCACAGGG No data
Right 1180414299 22:12694047-12694069 CAGGGACGGCCCTCGCTCCCTGG No data
1180414288_1180414299 12 Left 1180414288 22:12694012-12694034 CCCCTCTGCCGGCACGGCCAGGC No data
Right 1180414299 22:12694047-12694069 CAGGGACGGCCCTCGCTCCCTGG No data
1180414289_1180414299 11 Left 1180414289 22:12694013-12694035 CCCTCTGCCGGCACGGCCAGGCT No data
Right 1180414299 22:12694047-12694069 CAGGGACGGCCCTCGCTCCCTGG No data
1180414290_1180414299 10 Left 1180414290 22:12694014-12694036 CCTCTGCCGGCACGGCCAGGCTG No data
Right 1180414299 22:12694047-12694069 CAGGGACGGCCCTCGCTCCCTGG No data
1180414292_1180414299 4 Left 1180414292 22:12694020-12694042 CCGGCACGGCCAGGCTGGCCTGG No data
Right 1180414299 22:12694047-12694069 CAGGGACGGCCCTCGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180414299 Original CRISPR CAGGGACGGCCCTCGCTCCC TGG Intergenic
No off target data available for this crispr