ID: 1180414304

View in Genome Browser
Species Human (GRCh38)
Location 22:12694067-12694089
Sequence TGGCTCACGAAAGCCCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180414298_1180414304 6 Left 1180414298 22:12694038-12694060 CCTGGAGCACAGGGACGGCCCTC No data
Right 1180414304 22:12694067-12694089 TGGCTCACGAAAGCCCCCTGAGG No data
1180414295_1180414304 15 Left 1180414295 22:12694029-12694051 CCAGGCTGGCCTGGAGCACAGGG No data
Right 1180414304 22:12694067-12694089 TGGCTCACGAAAGCCCCCTGAGG No data
1180414290_1180414304 30 Left 1180414290 22:12694014-12694036 CCTCTGCCGGCACGGCCAGGCTG No data
Right 1180414304 22:12694067-12694089 TGGCTCACGAAAGCCCCCTGAGG No data
1180414292_1180414304 24 Left 1180414292 22:12694020-12694042 CCGGCACGGCCAGGCTGGCCTGG No data
Right 1180414304 22:12694067-12694089 TGGCTCACGAAAGCCCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180414304 Original CRISPR TGGCTCACGAAAGCCCCCTG AGG Intergenic