ID: 1180414304

View in Genome Browser
Species Human (GRCh38)
Location 22:12694067-12694089
Sequence TGGCTCACGAAAGCCCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 38, 1: 12, 2: 10, 3: 8, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180414290_1180414304 30 Left 1180414290 22:12694014-12694036 CCTCTGCCGGCACGGCCAGGCTG No data
Right 1180414304 22:12694067-12694089 TGGCTCACGAAAGCCCCCTGAGG 0: 38
1: 12
2: 10
3: 8
4: 115
1180414295_1180414304 15 Left 1180414295 22:12694029-12694051 CCAGGCTGGCCTGGAGCACAGGG No data
Right 1180414304 22:12694067-12694089 TGGCTCACGAAAGCCCCCTGAGG 0: 38
1: 12
2: 10
3: 8
4: 115
1180414298_1180414304 6 Left 1180414298 22:12694038-12694060 CCTGGAGCACAGGGACGGCCCTC No data
Right 1180414304 22:12694067-12694089 TGGCTCACGAAAGCCCCCTGAGG 0: 38
1: 12
2: 10
3: 8
4: 115
1180414292_1180414304 24 Left 1180414292 22:12694020-12694042 CCGGCACGGCCAGGCTGGCCTGG No data
Right 1180414304 22:12694067-12694089 TGGCTCACGAAAGCCCCCTGAGG 0: 38
1: 12
2: 10
3: 8
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180414304 Original CRISPR TGGCTCACGAAAGCCCCCTG AGG Intergenic
902361640 1:15945305-15945327 TGGCCAAGGAAAGCCCCCGGGGG + Intronic
904410513 1:30322183-30322205 TGTCTCAGGAGAGGCCCCTGAGG - Intergenic
905518444 1:38579030-38579052 AGCCTCACAAAAGCCCCCTGAGG - Intergenic
912385185 1:109267996-109268018 TGGCCCACGAGAGCACCCAGCGG + Exonic
915238419 1:154502317-154502339 AGGCCCACGGAAGCCCCCTGCGG + Intronic
915558175 1:156671284-156671306 TGGCTCAGGAAAGCCCTCCTGGG - Exonic
919030983 1:192242424-192242446 AGGCTCAGGAAAGCTGCCTGGGG + Intergenic
919511617 1:198472384-198472406 TGGCTCACCAAGCACCCCTGTGG - Intergenic
920436862 1:205952590-205952612 TGGATCAGGAAAGAACCCTGTGG + Intergenic
923757470 1:236805549-236805571 TGGCTCACTCTAGCCCACTGTGG + Intronic
923921052 1:238564990-238565012 AGACTCAGGAAAGCCTCCTGGGG - Intergenic
924543279 1:245001384-245001406 TGGCTCATCAGAGTCCCCTGAGG + Intronic
924781570 1:247153830-247153852 ATGCTAACGAAAGCCCCCTTTGG + Intronic
1064551814 10:16508881-16508903 TGGCTCAGAAAAGGACCCTGTGG - Intronic
1065188820 10:23192784-23192806 TGGCTCACCGAGGCCCCCCGAGG - Exonic
1070728545 10:78808891-78808913 TCCCTCAAGGAAGCCCCCTGTGG - Intergenic
1076139427 10:128067977-128067999 TGGCTCAGGCAGGCCCTCTGTGG + Intronic
1076737082 10:132463749-132463771 TGGCCCACAGAAGCCCCATGGGG - Intergenic
1076947813 10:133664447-133664469 TGGCTCACGAAAGCCCCCTGTGG - Intergenic
1076948803 10:133667757-133667779 TGGCTCACGAAAGCCCCCTGTGG - Exonic
1076949787 10:133671056-133671078 TGGCTCACGAAAGCCCCCTGTGG - Intronic
1076950771 10:133674355-133674377 TGGCTCACGAAAGCCCCCTGTGG - Intergenic
1076951761 10:133677665-133677687 TGGCTCACGAAAGCCCCCTGTGG - Intergenic
1076952750 10:133680975-133680997 TGGCTCACGAAAGCCCCCTGTGG - Intergenic
1076953734 10:133684274-133684296 TGGCTCACGAAAGCCCCCTGTGG - Intergenic
1076954718 10:133740626-133740648 TGGCTCACGAAAGCCCCCTGTGG - Intergenic
1076955707 10:133743936-133743958 TGGCTCACGAAAGCCCCCTGTGG - Intergenic
1076956697 10:133747246-133747268 TGGCTCACGAAAGCCCCCTGTGG - Intergenic
1076957684 10:133750555-133750577 TGGCTCACGAAAGCCCCCTGTGG - Intergenic
1076958669 10:133753854-133753876 TGGCTCACGAAAGCCCCCTGTGG - Intergenic
1076959658 10:133757164-133757186 TGGCTCACGAAAGCCCCCTGTGG - Intergenic
1076960642 10:133760463-133760485 TGGCTCACGAAAGCCCCCTGTGG - Intergenic
1078406052 11:11070934-11070956 TGGCTCCCCAAAGAGCCCTGTGG + Intergenic
1079878983 11:25899810-25899832 GGGCTCAAGAAAGCTGCCTGAGG + Intergenic
1084215484 11:67645016-67645038 TGTTTCCCGAAAGTCCCCTGGGG + Intronic
1089320099 11:117619939-117619961 AGGCTCAATAAAGCTCCCTGGGG - Intronic
1094818714 12:34209051-34209073 TGGCTCACGAGAGCACCCTGTGG + Intergenic
1098631813 12:72732494-72732516 AGGCTCAGGAAAGCTGCCTGGGG + Intergenic
1099668981 12:85666715-85666737 TTGCTCATAAAAGCCCCTTGCGG - Intergenic
1105375687 13:19842247-19842269 TGGCTCTTGACAGCCCCCTGCGG - Intronic
1106121618 13:26864336-26864358 GGGCTGACCAAAGCCCCCAGAGG + Intergenic
1110413048 13:75224145-75224167 GGGCTCCTGAAAGCCTCCTGGGG - Intergenic
1113991488 14:16030757-16030779 TGGCTCACGAAAGCCCCCTGTGG + Intergenic
1116211264 14:41947892-41947914 GGGCACAAGAAAGCCACCTGGGG - Intergenic
1118309213 14:64680422-64680444 TGGCTCCCGAAGCCTCCCTGGGG + Intergenic
1118708513 14:68501456-68501478 TGCCTCACCAAAGCTCCATGGGG - Intronic
1119180122 14:72599946-72599968 TGGCTCTGGAAGTCCCCCTGAGG - Intergenic
1121436718 14:93925477-93925499 TGGCTGAAGAGAGCGCCCTGAGG - Intronic
1121530324 14:94648231-94648253 AGGCTCAGGAAAGCTGCCTGGGG + Intergenic
1122095014 14:99364160-99364182 TTCCTCACAAAAGGCCCCTGCGG - Intergenic
1202848476 14_GL000225v1_random:1199-1221 TGGCTCACGAAAGCCCCCTGTGG - Intergenic
1202849685 14_GL000225v1_random:8992-9014 TGGCTCACGAAATCCCCCAGTGG - Intergenic
1202852575 14_GL000225v1_random:30674-30696 TGGATCATGAAAGCCACCTTTGG - Intergenic
1202853645 14_GL000225v1_random:36966-36988 TGGCTCAAGAAAGCCCCCTGTGG - Intergenic
1202854755 14_GL000225v1_random:43408-43430 TGCCTCACGAAAGCCCCCTGTGG - Intergenic
1202857161 14_GL000225v1_random:58699-58721 TGGCACATGAAAGACCCCTGTGG - Intergenic
1202858205 14_GL000225v1_random:64314-64336 TGGCTCACGAAAGCCCCCTGTGG + Intergenic
1202859511 14_GL000225v1_random:72601-72623 TAGCTCACGAAAGCCCCCTGTGG + Intergenic
1202860686 14_GL000225v1_random:79432-79454 TGGCCCACGAAAGCCCCCTGAGG + Intergenic
1202862187 14_GL000225v1_random:89890-89912 TGGCTCACGAAAGCCCCCTGTGG + Intergenic
1202864268 14_GL000225v1_random:104947-104969 TGTCTCACAAAAGCCCCCTGTGG + Intergenic
1202868233 14_GL000225v1_random:136445-136467 TGGCTCAAGAAAGCCTCCTGTGG + Intergenic
1202921968 14_KI270723v1_random:35274-35296 TGGCTCATGAAAGCCCCCTGTGG - Intergenic
1129189111 15:73927321-73927343 TGGCTGACGAAGGGCGCCTGCGG - Exonic
1130609516 15:85348194-85348216 TGGCTCACTAAAGCCCACGGAGG + Intergenic
1133049892 16:3111718-3111740 TGGCTCACCAGAATCCCCTGAGG - Intergenic
1134064830 16:11221337-11221359 TGGCTCAGGATAGCCCCCAAGGG + Intergenic
1135345810 16:21687573-21687595 TGGCTGGAGAAAGCTCCCTGAGG - Exonic
1136910678 16:34141881-34141903 TGGCTCACGAAAGCCCCATGTGG + Intergenic
1136910768 16:34142521-34142543 TGGCTCACGAAAGCCCCATGTGG - Intergenic
1139528761 16:67531354-67531376 TGGCTCACCACAGCGCTCTGGGG - Intronic
1142218006 16:88839268-88839290 TGGCGCACGAGTGTCCCCTGTGG - Intronic
1144831864 17:18136350-18136372 TGCCTCCGGAAAGCCCCCAGGGG - Intronic
1148023601 17:44569696-44569718 AGGCTCACAAAAGCTGCCTGGGG + Intergenic
1149170229 17:53800933-53800955 TGGTTCACTAAATCCCTCTGAGG + Intergenic
1151893358 17:76964098-76964120 AGGCTAACGAAAGCTCCATGAGG + Intergenic
1153353606 18:4109615-4109637 GGGCTCAGGAAAGCCCCCACTGG - Intronic
1156462035 18:37326567-37326589 TGGCTCACCAAATCCCCTTCAGG - Intronic
1157606281 18:48927840-48927862 TGGCTCATGACAACCCTCTGAGG + Intronic
1160045774 18:75386129-75386151 TGGCTCACAAAAACCCCTGGAGG + Intergenic
1160903629 19:1441457-1441479 TGGCCCACAACAGCCTCCTGTGG + Intergenic
1163544613 19:17933570-17933592 TGGGTCACACAAGCCCTCTGGGG - Intronic
1164532965 19:29062064-29062086 AGGATCACCATAGCCCCCTGAGG - Intergenic
1164727118 19:30473448-30473470 AGGCTCAAGAAAGCTTCCTGGGG - Intronic
1165091733 19:33391487-33391509 TGGCTCACGGCAGCTCCCTCTGG - Intronic
1165433760 19:35786077-35786099 TGGCTCAGAAGAGCCCCCAGAGG - Intronic
930261359 2:49150398-49150420 GTCCTCACGAAAGCCCTCTGTGG + Intronic
931039963 2:58286297-58286319 AGGCTCAGGAAAGCTGCCTGTGG + Intergenic
934150964 2:89147162-89147184 AGGCTCAGGAAAGCTGCCTGGGG + Intergenic
934216309 2:90034863-90034885 AGGCTCAGGAAAGCTGCCTGGGG - Intergenic
938003321 2:127764959-127764981 AGGCTCACGACAGCCCAGTGAGG - Exonic
945884820 2:215363948-215363970 TGGCTCACCAAAGCCCACCTGGG + Intronic
945930346 2:215848813-215848835 GGGCTCAGGAAAGCTGCCTGGGG + Intergenic
948429310 2:237909104-237909126 TGGCTTACGGATGCCCACTGTGG + Intronic
948902623 2:240964097-240964119 GGGCTCTAGAAAGGCCCCTGTGG + Intronic
1169271479 20:4202707-4202729 AGGCTCAGGAAAGCAGCCTGGGG - Intergenic
1169271656 20:4204217-4204239 AGGCTCAGGAAAGCTGCCTGGGG + Intergenic
1171770390 20:29318929-29318951 TCGCTCACGAAAGCCCCCTGTGG - Intergenic
1171780243 20:29410972-29410994 TGGCTCACGAAAGCCCCCTGTGG + Intergenic
1171784422 20:29449182-29449204 TGGCTCACGAAAGCCCCCTGTGG + Intergenic
1171813100 20:29761727-29761749 TGGCTCACGAAAGCCCCCTGTGG - Intergenic
1171824206 20:29879236-29879258 TGGCTCACGAAAGCCCCCTGTGG + Intergenic
1171906133 20:30900589-30900611 TGGCTCATGAAAGCCCCATGTGG + Intergenic
1172025436 20:31945288-31945310 TGGCTCACCACAGCCATCTGTGG - Exonic
1172624790 20:36340776-36340798 TGGCTCCCGACAGCCCCCCGAGG - Intronic
1175414159 20:58790559-58790581 GGGCTCACAAATGCACCCTGGGG - Intergenic
1178003613 21:28192337-28192359 TGCCTCACCAAATCCCCCTTGGG + Intergenic
1179023524 21:37660079-37660101 GGGCACACCAAAGCCACCTGAGG - Intronic
1180315780 22:11276767-11276789 TGGCTCACGAAAGCCCCCTGTGG - Intergenic
1180339558 22:11606708-11606730 TGGCTCACGAAAGCCCCATGTGG + Intergenic
1180414304 22:12694067-12694089 TGGCTCACGAAAGCCCCCTGAGG + Intergenic
1182330786 22:29550450-29550472 TGCCTCACCACAGCCTCCTGAGG + Intronic
1183959410 22:41402274-41402296 AGGCTGATGAAAGCTCCCTGAGG - Intergenic
952511138 3:34057366-34057388 AGACTCACGAAAGCTGCCTGGGG - Intergenic
957084853 3:75669537-75669559 TGGCTCCCGAAAGCCCCCTGTGG - Intergenic
957639544 3:82834101-82834123 TGGGTCACCAAAGCCATCTGGGG - Intergenic
959461248 3:106628639-106628661 AGGCTCAGGAAAGCTGCCTGGGG + Intergenic
963915166 3:150852530-150852552 AGGCTCAGGAAAGCTGCCTGGGG - Intergenic
964248751 3:154685101-154685123 TTGCTCCTGAAGGCCCCCTGGGG - Intergenic
968046284 3:195625379-195625401 TGGGTCACAAAAGCCCCGGGAGG + Intergenic
968107544 3:196013313-196013335 TGGCTCACAAAGGCCCCATTTGG - Intergenic
968308368 3:197664712-197664734 TGGGTCACAAAAGCCCCGGGAGG - Intergenic
968666054 4:1822942-1822964 TGGCTCAGGACAGCCCCACGCGG + Intronic
968727882 4:2256668-2256690 TGTCTCAAGAAGGCCCCATGAGG + Intronic
969445088 4:7240150-7240172 GGGATCACGACAGCCCCGTGGGG - Intronic
969492792 4:7509604-7509626 TGGTTCACCCCAGCCCCCTGTGG - Intronic
975885204 4:78956885-78956907 AGGCTCAGGAAAGCTGCCTGGGG - Intergenic
977071001 4:92387651-92387673 TGGCTCTGGAAAGCTCCCTCTGG + Intronic
985446116 4:190022037-190022059 TGGCTCACGAAAGCCCCCTGTGG + Intergenic
985451266 4:190065246-190065268 TGGCTCACGAAAGCCCCCTGTGG - Intergenic
985452257 4:190068541-190068563 TGGCTCACGAAAGCCCCCTGTGG - Intergenic
985453241 4:190071838-190071860 TGGCTCACGAAAGCCCCCTGTGG - Exonic
985454231 4:190075131-190075153 TGGCTCACGAAAGCCCCCTGTGG - Exonic
985455219 4:190078424-190078446 TGGCTCACGAAAGCCCCCTGTGG - Exonic
985456207 4:190081724-190081746 TGGCTCACGAAAGCCCCCTGTGG - Exonic
985457191 4:190085018-190085040 TGGCTCACGAAAGCCCCCTGTGG - Intergenic
985458178 4:190088311-190088333 TGGCTCACGAAAGCCCCCTGTGG - Exonic
985459167 4:190091611-190091633 TGGCTCACGAAAGCCCCCTGTGG - Exonic
985463420 4:190174380-190174402 TGGCTCACGAAAGCCCCCTGTGG - Exonic
985574805 5:669145-669167 TGTCTCCCCAAAGCCCCCTCCGG - Intronic
985574836 5:669260-669282 GGGCTCACCAGCGCCCCCTGGGG - Intronic
985579813 5:690689-690711 GTGCCCACGGAAGCCCCCTGCGG + Intronic
985594659 5:782748-782770 GTGCCCACGGAAGCCCCCTGCGG + Intergenic
988403429 5:30793101-30793123 AGGCTCAAGAAAGCTGCCTGGGG + Intergenic
988519788 5:31935285-31935307 TGGATCATGAAAGACCCCTTTGG + Intronic
989241016 5:39202768-39202790 TGGGTCCCCAAAGCCACCTGTGG - Exonic
989527289 5:42468162-42468184 TGTCTGACGAAACTCCCCTGGGG + Intronic
997209029 5:132066939-132066961 TGGTTCACTAATGCCCACTGAGG + Intergenic
998830600 5:146154270-146154292 GGGCTCAGGCAAGCCTCCTGAGG + Intronic
1001449447 5:171812935-171812957 AGGCTCACGAGAGCCCCATGAGG + Intergenic
1002357496 5:178642586-178642608 GGGCTCAGGAAAGCCCCCTGAGG + Intergenic
1006296860 6:33173643-33173665 TGGCTCACCCAGGCTCCCTGGGG + Intronic
1006578673 6:35064098-35064120 GGGCTCTCGAAAGCCACGTGTGG + Intronic
1008286623 6:49660649-49660671 AGGCTCAGGAAAGCTGCCTGGGG - Intergenic
1010816298 6:80361537-80361559 TGTAGCAGGAAAGCCCCCTGGGG + Intergenic
1014210880 6:118706929-118706951 TGGCTCATGAGAGCTCCATGGGG - Intronic
1014873483 6:126626595-126626617 TGGCTTACCAAAGCCAACTGTGG - Intergenic
1017454931 6:154593177-154593199 GGGCTCACCAAAGCCCCATAGGG + Intergenic
1026569624 7:71517984-71518006 CAGCTCATGAAAGGCCCCTGGGG + Intronic
1036185445 8:6618913-6618935 TGGATCACTGAAGCCCCCAGAGG - Intronic
1036691042 8:10944945-10944967 TGGCAGAGGAAAGCACCCTGAGG + Intronic
1037892069 8:22628758-22628780 TGGCACAGAAAAGCCCTCTGTGG + Intronic
1039463060 8:37762344-37762366 TGCCTCACAAAAGTCCCTTGGGG + Intergenic
1045474001 8:102537839-102537861 TGGCTTACCAGAGCCACCTGGGG + Intronic
1047215848 8:122875507-122875529 TGGGTCATGAAAGCACCTTGGGG + Intronic
1047542633 8:125785199-125785221 TGACTCACGCAAGCCACCTACGG + Intergenic
1053509175 9:38672680-38672702 CGGCTCACGGAAGTGCCCTGTGG + Intergenic
1053515929 9:38730698-38730720 GAGCTCACCAAAGTCCCCTGTGG + Intergenic
1053748998 9:41234983-41235005 TGGCTCATGAAAGCCCCCTGTGG - Intergenic
1054337380 9:63818372-63818394 TGGCTCACGAAAGCCCCCTGTGG + Intergenic
1062267172 9:135692509-135692531 CCCCTCACCAAAGCCCCCTGGGG + Intergenic
1203736543 Un_GL000216v2:143823-143845 TGTCTCAAGAAAGCCTCCTGTGG - Intergenic
1203740055 Un_GL000216v2:171069-171091 TGTCTCACAAAAGCCCCCTGTGG - Intergenic
1203445028 Un_GL000219v1:46061-46083 TGGCTCACGAAAGCCCCCTGTGG + Intergenic
1203364073 Un_KI270442v1:242722-242744 TGGCTCACGAAAGCCCCCTGTGG - Intergenic
1203377279 Un_KI270442v1:385681-385703 TGGCTCACGAAAGCCCCCACTGG + Intergenic
1196014121 X:110919359-110919381 TGGTTCAAGAAAGCCACCTCTGG - Intergenic
1197034793 X:121860272-121860294 TGGCTCAAGAAAGCCAGGTGTGG - Intergenic
1201175737 Y:11307523-11307545 TGGCTCATGAAAGCCCCTTGTGG - Intergenic
1201176997 Y:11315527-11315549 TGGCTCATGAAAGCCCCCTGTGG - Intergenic
1201179701 Y:11332937-11332959 TGGCTCACAAAAGCTCCCTGTGG - Intergenic
1202380643 Y:24274329-24274351 TGGCCCACTAAAGCCCACGGAGG + Intergenic
1202490141 Y:25395796-25395818 TGGCCCACTAAAGCCCACGGAGG - Intergenic