ID: 1180414305

View in Genome Browser
Species Human (GRCh38)
Location 22:12694068-12694090
Sequence GGCTCACGAAAGCCCCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180414292_1180414305 25 Left 1180414292 22:12694020-12694042 CCGGCACGGCCAGGCTGGCCTGG No data
Right 1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG No data
1180414298_1180414305 7 Left 1180414298 22:12694038-12694060 CCTGGAGCACAGGGACGGCCCTC No data
Right 1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG No data
1180414295_1180414305 16 Left 1180414295 22:12694029-12694051 CCAGGCTGGCCTGGAGCACAGGG No data
Right 1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180414305 Original CRISPR GGCTCACGAAAGCCCCCTGA GGG Intergenic
No off target data available for this crispr