ID: 1180414306

View in Genome Browser
Species Human (GRCh38)
Location 22:12694079-12694101
Sequence GCCCCCTGAGGGAGAGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180414298_1180414306 18 Left 1180414298 22:12694038-12694060 CCTGGAGCACAGGGACGGCCCTC No data
Right 1180414306 22:12694079-12694101 GCCCCCTGAGGGAGAGCCCCAGG No data
1180414303_1180414306 -9 Left 1180414303 22:12694065-12694087 CCTGGCTCACGAAAGCCCCCTGA No data
Right 1180414306 22:12694079-12694101 GCCCCCTGAGGGAGAGCCCCAGG No data
1180414300_1180414306 0 Left 1180414300 22:12694056-12694078 CCCTCGCTCCCTGGCTCACGAAA No data
Right 1180414306 22:12694079-12694101 GCCCCCTGAGGGAGAGCCCCAGG No data
1180414302_1180414306 -8 Left 1180414302 22:12694064-12694086 CCCTGGCTCACGAAAGCCCCCTG No data
Right 1180414306 22:12694079-12694101 GCCCCCTGAGGGAGAGCCCCAGG No data
1180414301_1180414306 -1 Left 1180414301 22:12694057-12694079 CCTCGCTCCCTGGCTCACGAAAG No data
Right 1180414306 22:12694079-12694101 GCCCCCTGAGGGAGAGCCCCAGG No data
1180414295_1180414306 27 Left 1180414295 22:12694029-12694051 CCAGGCTGGCCTGGAGCACAGGG No data
Right 1180414306 22:12694079-12694101 GCCCCCTGAGGGAGAGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180414306 Original CRISPR GCCCCCTGAGGGAGAGCCCC AGG Intergenic
No off target data available for this crispr