ID: 1180420876

View in Genome Browser
Species Human (GRCh38)
Location 22:12813652-12813674
Sequence GGTAATGTGTCTAGAGCGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180420876_1180420887 20 Left 1180420876 22:12813652-12813674 CCCAACGCTCTAGACACATTACC No data
Right 1180420887 22:12813695-12813717 TGAAAAAGAAAAACTTCTCCAGG No data
1180420876_1180420889 22 Left 1180420876 22:12813652-12813674 CCCAACGCTCTAGACACATTACC No data
Right 1180420889 22:12813697-12813719 AAAAAGAAAAACTTCTCCAGGGG No data
1180420876_1180420888 21 Left 1180420876 22:12813652-12813674 CCCAACGCTCTAGACACATTACC No data
Right 1180420888 22:12813696-12813718 GAAAAAGAAAAACTTCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180420876 Original CRISPR GGTAATGTGTCTAGAGCGTT GGG (reversed) Intergenic
No off target data available for this crispr