ID: 1180432226

View in Genome Browser
Species Human (GRCh38)
Location 22:15263465-15263487
Sequence GGCGCGAGCCAAGGAAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180432218_1180432226 25 Left 1180432218 22:15263417-15263439 CCATACTGGCGACTGCACAGTCC No data
Right 1180432226 22:15263465-15263487 GGCGCGAGCCAAGGAAGAGCAGG No data
1180432220_1180432226 3 Left 1180432220 22:15263439-15263461 CCCAGAGTCTGCAAACCAGCGCT No data
Right 1180432226 22:15263465-15263487 GGCGCGAGCCAAGGAAGAGCAGG No data
1180432217_1180432226 26 Left 1180432217 22:15263416-15263438 CCCATACTGGCGACTGCACAGTC No data
Right 1180432226 22:15263465-15263487 GGCGCGAGCCAAGGAAGAGCAGG No data
1180432216_1180432226 27 Left 1180432216 22:15263415-15263437 CCCCATACTGGCGACTGCACAGT No data
Right 1180432226 22:15263465-15263487 GGCGCGAGCCAAGGAAGAGCAGG No data
1180432221_1180432226 2 Left 1180432221 22:15263440-15263462 CCAGAGTCTGCAAACCAGCGCTC No data
Right 1180432226 22:15263465-15263487 GGCGCGAGCCAAGGAAGAGCAGG No data
1180432219_1180432226 4 Left 1180432219 22:15263438-15263460 CCCCAGAGTCTGCAAACCAGCGC No data
Right 1180432226 22:15263465-15263487 GGCGCGAGCCAAGGAAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180432226 Original CRISPR GGCGCGAGCCAAGGAAGAGC AGG Intergenic
No off target data available for this crispr