ID: 1180439988

View in Genome Browser
Species Human (GRCh38)
Location 22:15355712-15355734
Sequence ATTCCAGGACACTACCATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180439988_1180439994 11 Left 1180439988 22:15355712-15355734 CCCTTATGGTAGTGTCCTGGAAT No data
Right 1180439994 22:15355746-15355768 GTAACACTCTCAGAACCCAACGG No data
1180439988_1180439995 22 Left 1180439988 22:15355712-15355734 CCCTTATGGTAGTGTCCTGGAAT No data
Right 1180439995 22:15355757-15355779 AGAACCCAACGGCAGCGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180439988 Original CRISPR ATTCCAGGACACTACCATAA GGG (reversed) Intergenic
No off target data available for this crispr