ID: 1180445451

View in Genome Browser
Species Human (GRCh38)
Location 22:15408891-15408913
Sequence ATGTGTCTCTAACATTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180445446_1180445451 11 Left 1180445446 22:15408857-15408879 CCCTCAGAAACCAGCAGCAGTGT No data
Right 1180445451 22:15408891-15408913 ATGTGTCTCTAACATTCTGAGGG No data
1180445445_1180445451 28 Left 1180445445 22:15408840-15408862 CCTATGTGAGGGACAAACCCTCA No data
Right 1180445451 22:15408891-15408913 ATGTGTCTCTAACATTCTGAGGG No data
1180445449_1180445451 1 Left 1180445449 22:15408867-15408889 CCAGCAGCAGTGTTCTGGAATTC No data
Right 1180445451 22:15408891-15408913 ATGTGTCTCTAACATTCTGAGGG No data
1180445447_1180445451 10 Left 1180445447 22:15408858-15408880 CCTCAGAAACCAGCAGCAGTGTT No data
Right 1180445451 22:15408891-15408913 ATGTGTCTCTAACATTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180445451 Original CRISPR ATGTGTCTCTAACATTCTGA GGG Intergenic
No off target data available for this crispr