ID: 1180448590

View in Genome Browser
Species Human (GRCh38)
Location 22:15439495-15439517
Sequence CAGAAACAGCAGCAGTGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180448590_1180448591 -6 Left 1180448590 22:15439495-15439517 CCAGAACACTGCTGCTGTTTCTG No data
Right 1180448591 22:15439512-15439534 TTTCTGTTTGTCCCTCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180448590 Original CRISPR CAGAAACAGCAGCAGTGTTC TGG (reversed) Intergenic
No off target data available for this crispr