ID: 1180455642

View in Genome Browser
Species Human (GRCh38)
Location 22:15511297-15511319
Sequence CGCAGCCGCCAGGGAGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180455642_1180455651 -3 Left 1180455642 22:15511297-15511319 CCAGTCCCTCCCTGGCGGCTGCG No data
Right 1180455651 22:15511317-15511339 GCGGAGCCGTCCGAGGACAGGGG No data
1180455642_1180455649 -5 Left 1180455642 22:15511297-15511319 CCAGTCCCTCCCTGGCGGCTGCG No data
Right 1180455649 22:15511315-15511337 CTGCGGAGCCGTCCGAGGACAGG No data
1180455642_1180455654 17 Left 1180455642 22:15511297-15511319 CCAGTCCCTCCCTGGCGGCTGCG No data
Right 1180455654 22:15511337-15511359 GGGCCATAAACTCTCCAGAGCGG No data
1180455642_1180455648 -10 Left 1180455642 22:15511297-15511319 CCAGTCCCTCCCTGGCGGCTGCG No data
Right 1180455648 22:15511310-15511332 GGCGGCTGCGGAGCCGTCCGAGG No data
1180455642_1180455655 18 Left 1180455642 22:15511297-15511319 CCAGTCCCTCCCTGGCGGCTGCG No data
Right 1180455655 22:15511338-15511360 GGCCATAAACTCTCCAGAGCGGG No data
1180455642_1180455650 -4 Left 1180455642 22:15511297-15511319 CCAGTCCCTCCCTGGCGGCTGCG No data
Right 1180455650 22:15511316-15511338 TGCGGAGCCGTCCGAGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180455642 Original CRISPR CGCAGCCGCCAGGGAGGGAC TGG (reversed) Intergenic
No off target data available for this crispr