ID: 1180460033

View in Genome Browser
Species Human (GRCh38)
Location 22:15554024-15554046
Sequence GGGCGAGGCGAGCACAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180460020_1180460033 14 Left 1180460020 22:15553987-15554009 CCGCGCCGCCTGAGCCGGGCTCA No data
Right 1180460033 22:15554024-15554046 GGGCGAGGCGAGCACAGGCCTGG No data
1180460022_1180460033 6 Left 1180460022 22:15553995-15554017 CCTGAGCCGGGCTCAGTCTTCCT No data
Right 1180460033 22:15554024-15554046 GGGCGAGGCGAGCACAGGCCTGG No data
1180460017_1180460033 21 Left 1180460017 22:15553980-15554002 CCGCGCGCCGCGCCGCCTGAGCC No data
Right 1180460033 22:15554024-15554046 GGGCGAGGCGAGCACAGGCCTGG No data
1180460023_1180460033 0 Left 1180460023 22:15554001-15554023 CCGGGCTCAGTCTTCCTCCCCCT No data
Right 1180460033 22:15554024-15554046 GGGCGAGGCGAGCACAGGCCTGG No data
1180460021_1180460033 9 Left 1180460021 22:15553992-15554014 CCGCCTGAGCCGGGCTCAGTCTT No data
Right 1180460033 22:15554024-15554046 GGGCGAGGCGAGCACAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180460033 Original CRISPR GGGCGAGGCGAGCACAGGCC TGG Intergenic
No off target data available for this crispr