ID: 1180460203

View in Genome Browser
Species Human (GRCh38)
Location 22:15555957-15555979
Sequence TCAAACTTCGGCATATAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180460203_1180460209 9 Left 1180460203 22:15555957-15555979 CCCTGCTATATGCCGAAGTTTGA No data
Right 1180460209 22:15555989-15556011 CACTATACCATGCTGCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180460203 Original CRISPR TCAAACTTCGGCATATAGCA GGG (reversed) Intergenic