ID: 1180460206

View in Genome Browser
Species Human (GRCh38)
Location 22:15555969-15555991
Sequence GTGGTATGGCCGTCAAACTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180460206_1180460209 -3 Left 1180460206 22:15555969-15555991 CCGAAGTTTGACGGCCATACCAC No data
Right 1180460209 22:15555989-15556011 CACTATACCATGCTGCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180460206 Original CRISPR GTGGTATGGCCGTCAAACTT CGG (reversed) Intergenic
No off target data available for this crispr