ID: 1180460209 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:15555989-15556011 |
| Sequence | CACTATACCATGCTGCCTTA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1180460203_1180460209 | 9 | Left | 1180460203 | 22:15555957-15555979 | CCCTGCTATATGCCGAAGTTTGA | No data | ||
| Right | 1180460209 | 22:15555989-15556011 | CACTATACCATGCTGCCTTATGG | No data | ||||
| 1180460202_1180460209 | 18 | Left | 1180460202 | 22:15555948-15555970 | CCTAGGCAACCCTGCTATATGCC | No data | ||
| Right | 1180460209 | 22:15555989-15556011 | CACTATACCATGCTGCCTTATGG | No data | ||||
| 1180460204_1180460209 | 8 | Left | 1180460204 | 22:15555958-15555980 | CCTGCTATATGCCGAAGTTTGAC | No data | ||
| Right | 1180460209 | 22:15555989-15556011 | CACTATACCATGCTGCCTTATGG | No data | ||||
| 1180460206_1180460209 | -3 | Left | 1180460206 | 22:15555969-15555991 | CCGAAGTTTGACGGCCATACCAC | No data | ||
| Right | 1180460209 | 22:15555989-15556011 | CACTATACCATGCTGCCTTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1180460209 | Original CRISPR | CACTATACCATGCTGCCTTA TGG | Intergenic | ||