ID: 1180460209

View in Genome Browser
Species Human (GRCh38)
Location 22:15555989-15556011
Sequence CACTATACCATGCTGCCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180460203_1180460209 9 Left 1180460203 22:15555957-15555979 CCCTGCTATATGCCGAAGTTTGA No data
Right 1180460209 22:15555989-15556011 CACTATACCATGCTGCCTTATGG No data
1180460202_1180460209 18 Left 1180460202 22:15555948-15555970 CCTAGGCAACCCTGCTATATGCC No data
Right 1180460209 22:15555989-15556011 CACTATACCATGCTGCCTTATGG No data
1180460204_1180460209 8 Left 1180460204 22:15555958-15555980 CCTGCTATATGCCGAAGTTTGAC No data
Right 1180460209 22:15555989-15556011 CACTATACCATGCTGCCTTATGG No data
1180460206_1180460209 -3 Left 1180460206 22:15555969-15555991 CCGAAGTTTGACGGCCATACCAC No data
Right 1180460209 22:15555989-15556011 CACTATACCATGCTGCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180460209 Original CRISPR CACTATACCATGCTGCCTTA TGG Intergenic