ID: 1180465811

View in Genome Browser
Species Human (GRCh38)
Location 22:15609080-15609102
Sequence CCTGAGAAGAAGGAGCGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180465806_1180465811 16 Left 1180465806 22:15609041-15609063 CCTAATTTCAATATTGTTGTGTA No data
Right 1180465811 22:15609080-15609102 CCTGAGAAGAAGGAGCGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180465811 Original CRISPR CCTGAGAAGAAGGAGCGAGC TGG Intergenic
No off target data available for this crispr