ID: 1180466071

View in Genome Browser
Species Human (GRCh38)
Location 22:15612644-15612666
Sequence CCATCCAGGAAAACACTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180466067_1180466071 -2 Left 1180466067 22:15612623-15612645 CCAAGCTTGACGTTTTGCTTGCC No data
Right 1180466071 22:15612644-15612666 CCATCCAGGAAAACACTGGCTGG No data
1180466064_1180466071 8 Left 1180466064 22:15612613-15612635 CCCCAAATCTCCAAGCTTGACGT No data
Right 1180466071 22:15612644-15612666 CCATCCAGGAAAACACTGGCTGG No data
1180466065_1180466071 7 Left 1180466065 22:15612614-15612636 CCCAAATCTCCAAGCTTGACGTT No data
Right 1180466071 22:15612644-15612666 CCATCCAGGAAAACACTGGCTGG No data
1180466066_1180466071 6 Left 1180466066 22:15612615-15612637 CCAAATCTCCAAGCTTGACGTTT No data
Right 1180466071 22:15612644-15612666 CCATCCAGGAAAACACTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180466071 Original CRISPR CCATCCAGGAAAACACTGGC TGG Intergenic
No off target data available for this crispr