ID: 1180468137

View in Genome Browser
Species Human (GRCh38)
Location 22:15635285-15635307
Sequence GTGGTGCATCGACCTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180468129_1180468137 20 Left 1180468129 22:15635242-15635264 CCTAGTGCTTGTCCGGGAGCTGC No data
Right 1180468137 22:15635285-15635307 GTGGTGCATCGACCTGAGGAAGG No data
1180468131_1180468137 8 Left 1180468131 22:15635254-15635276 CCGGGAGCTGCAGCTGCCTGGAG No data
Right 1180468137 22:15635285-15635307 GTGGTGCATCGACCTGAGGAAGG No data
1180468135_1180468137 -8 Left 1180468135 22:15635270-15635292 CCTGGAGGTCACGCGGTGGTGCA No data
Right 1180468137 22:15635285-15635307 GTGGTGCATCGACCTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180468137 Original CRISPR GTGGTGCATCGACCTGAGGA AGG Intergenic
No off target data available for this crispr