ID: 1180470608

View in Genome Browser
Species Human (GRCh38)
Location 22:15651823-15651845
Sequence CAAAGCAAACAATATAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180470608_1180470613 19 Left 1180470608 22:15651823-15651845 CCCACTTTATATTGTTTGCTTTG No data
Right 1180470613 22:15651865-15651887 AAGTATTTGAGTTTACTTCTGGG No data
1180470608_1180470610 -8 Left 1180470608 22:15651823-15651845 CCCACTTTATATTGTTTGCTTTG No data
Right 1180470610 22:15651838-15651860 TTGCTTTGTCAAAGACCAGTTGG 0: 22
1: 424
2: 708
3: 1108
4: 2105
1180470608_1180470612 18 Left 1180470608 22:15651823-15651845 CCCACTTTATATTGTTTGCTTTG No data
Right 1180470612 22:15651864-15651886 TAAGTATTTGAGTTTACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180470608 Original CRISPR CAAAGCAAACAATATAAAGT GGG (reversed) Intergenic
No off target data available for this crispr