ID: 1180473356

View in Genome Browser
Species Human (GRCh38)
Location 22:15681758-15681780
Sequence CCTGAAGGACATTAAGTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180473356_1180473363 23 Left 1180473356 22:15681758-15681780 CCTTTAACTTAATGTCCTTCAGG No data
Right 1180473363 22:15681804-15681826 CCTGATATCCAGAAGTTTGATGG No data
1180473356_1180473359 -6 Left 1180473356 22:15681758-15681780 CCTTTAACTTAATGTCCTTCAGG No data
Right 1180473359 22:15681775-15681797 TTCAGGTTTCTCCACCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180473356 Original CRISPR CCTGAAGGACATTAAGTTAA AGG (reversed) Intergenic
No off target data available for this crispr