ID: 1180473360

View in Genome Browser
Species Human (GRCh38)
Location 22:15681786-15681808
Sequence TCAGGTCACTTCCAGCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180473360_1180473363 -5 Left 1180473360 22:15681786-15681808 CCACCTTGCTGGAAGTGACCTGA No data
Right 1180473363 22:15681804-15681826 CCTGATATCCAGAAGTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180473360 Original CRISPR TCAGGTCACTTCCAGCAAGG TGG (reversed) Intergenic
No off target data available for this crispr