ID: 1180473363

View in Genome Browser
Species Human (GRCh38)
Location 22:15681804-15681826
Sequence CCTGATATCCAGAAGTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180473360_1180473363 -5 Left 1180473360 22:15681786-15681808 CCACCTTGCTGGAAGTGACCTGA No data
Right 1180473363 22:15681804-15681826 CCTGATATCCAGAAGTTTGATGG No data
1180473356_1180473363 23 Left 1180473356 22:15681758-15681780 CCTTTAACTTAATGTCCTTCAGG No data
Right 1180473363 22:15681804-15681826 CCTGATATCCAGAAGTTTGATGG No data
1180473358_1180473363 8 Left 1180473358 22:15681773-15681795 CCTTCAGGTTTCTCCACCTTGCT No data
Right 1180473363 22:15681804-15681826 CCTGATATCCAGAAGTTTGATGG No data
1180473361_1180473363 -8 Left 1180473361 22:15681789-15681811 CCTTGCTGGAAGTGACCTGATAT No data
Right 1180473363 22:15681804-15681826 CCTGATATCCAGAAGTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180473363 Original CRISPR CCTGATATCCAGAAGTTTGA TGG Intergenic
No off target data available for this crispr