ID: 1180473618

View in Genome Browser
Species Human (GRCh38)
Location 22:15684365-15684387
Sequence TAGAAAATGCAGAAGTAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180473618_1180473620 -1 Left 1180473618 22:15684365-15684387 CCAGGCTACTTCTGCATTTTCTA No data
Right 1180473620 22:15684387-15684409 AACTTGTCTAGGTGAAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180473618 Original CRISPR TAGAAAATGCAGAAGTAGCC TGG (reversed) Intergenic
No off target data available for this crispr