ID: 1180473618 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:15684365-15684387 |
| Sequence | TAGAAAATGCAGAAGTAGCC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1180473618_1180473620 | -1 | Left | 1180473618 | 22:15684365-15684387 | CCAGGCTACTTCTGCATTTTCTA | No data | ||
| Right | 1180473620 | 22:15684387-15684409 | AACTTGTCTAGGTGAAAGCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1180473618 | Original CRISPR | TAGAAAATGCAGAAGTAGCC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||