ID: 1180474028

View in Genome Browser
Species Human (GRCh38)
Location 22:15687380-15687402
Sequence GTGTCCCAGGGCACCCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180474028_1180474034 -5 Left 1180474028 22:15687380-15687402 CCACTGAGGGTGCCCTGGGACAC No data
Right 1180474034 22:15687398-15687420 GACACAAAGCTGGTGGGAAGAGG No data
1180474028_1180474035 -1 Left 1180474028 22:15687380-15687402 CCACTGAGGGTGCCCTGGGACAC No data
Right 1180474035 22:15687402-15687424 CAAAGCTGGTGGGAAGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180474028 Original CRISPR GTGTCCCAGGGCACCCTCAG TGG (reversed) Intergenic
No off target data available for this crispr