ID: 1180476090

View in Genome Browser
Species Human (GRCh38)
Location 22:15708991-15709013
Sequence TTCTGTTTAGGGAGGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180476084_1180476090 5 Left 1180476084 22:15708963-15708985 CCTTGTGGTCTCTCATTGACCTC No data
Right 1180476090 22:15708991-15709013 TTCTGTTTAGGGAGGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180476090 Original CRISPR TTCTGTTTAGGGAGGGAACC AGG Intronic
No off target data available for this crispr